For collagen I, II, and X detection, slides were incubated in Alexa Fluor 555, 488, and 555 goat anti-rabbit antibody (Invitrogen, diluted 1:500), respectively, for 30 min and then

mounted with DAPI mounting medium (Vector Laboratories). To detect cell death, TUNEL (In Situ Cell Death Detection Kit, Roche) was performed as described by the manufacturer. Imaging of the stained tissue sections was performed with a Leica DM 5000B fluorescent microscope and a Leica DFC 500 digital camera. Mucoperiosteal denudation was performed and animals were sacrificed at 7, 14, 21, and 28 days (Table 1). Tissues from all mice were harvested by microscopic dissection selleck inhibitor from 8 injured and 8 control mice for each of the four time points reported, for a total of 64 mice (Table 1). The epidermis was removed and the midpalatal suture complex, which included the medial edges of the palatine bones, its growth plates, and the fibrous interzone, was collected then homogenized in TRIzol (Invitrogen). RNA was quantified, and qRT-PCR was performed (Quantace Bioline, Taunton, MA). Expression levels were calculated using the 2Δ-(ddCt) method,

normalized to GAPDH [29], and converted to fold-expression. XL184 The following primer sets were used: GAPDH, acccagaagactgtggatgg and ggatgcagggatgatgttct; Sox9, agaacaagccacacgtcaag and cagcagcctccagagctt. ALP, accttgactgtggttactgc and catataggatggccgtgaagg; OPN, catgaagagcggtgagtctaag and ttccagacttggttcatccag. Micro-CT

scanning (Imtek/Siemens MicroCAT II/SPECT system, 52 μm resolution) was performed GABA Receptor using six injured and six age-matched control mice on PID28. Scanning results were exported into DICOM format and Osirix software version 5.8 (Pixmeo, Bernex, Switzerland) was employed to render the 3D multiplanar reconstruction in order to evaluate coronal sections across the midpalatal suture complex at exactly the same axis for each sample. Distances between left and right palatine foramen were measured and reported as inter-foraminal width. These skeletal landmarks were used as fiducials to assess the effect of the mucoperiosteal denudation injury on mediolateral expansion of the hard palate. For histomorphometric analyses, tissues from 6 injured and 6 control mice were used for each of the four time points reported, for a total of 48 mice (Table 1). The palate was sectioned at 8 μm thickness/section and collected from the area bound by the first and second molars, corresponding to the middle region of the injury. Each slide contained two tissue sections. From the resulting ~ 30 slides, 6 slides were chosen (one every fifth slide) in order to perform the following quantifications. Tissue sections were stained with Ki67, Safranin O, or TUNEL protocols.